General Purpose Reagents - Applied BioCode

The BioCode® DNA-IC Pack is intended to be used as an extraction, amplification, and detection control for PCR assays using Barcoded Magnetic Bead (BMB)-based capture and detection.

The BioCode® DNA-IC is added to each sample prior to extraction. Amplification is then performed using the BioCode® DNA-IC Primer Pair (separately or combined with target-specific primers). The primer pair concentration should be optimized for the specific reaction (recommended starting concentration during optimization is 1/10 of the total PCR volume). Capture and detection of the biotinylated
amplicon is performed by adding the BioCode® DNA-IC BMB-Probe to the capture/detection plate (separately or combined with a target-specific BMB-Probe(s); recommended amount is 100 BMB/assay well).

Part Number: 64-D0001

Contains:

BioCode® DNA-IC Primer Pair (125μL x 2 vials)
BioCode® DNA-IC BMB Probe (250 μL x 1 vial)
BioCode® DNA-IC (500μL x 2 vials)

Get More Information

The BioCode® Master Mix A contains the necessary components to perform polymerase chain reaction (PCR) except target-specific primers. It contains an antibody mediated hot start Taq DNA polymerase, dNTPs, Buffer, MgCl2 and Uracil-DNA glycosylase (UNG; for contamination control). The hot start polymerase is bound to an antibody that blocks polymerase activity. The activity is restored when heated at 94-95oC for two minutes. The Uracil-DNA glycosylase is active between 20-40oC and is irreversibly inactivated by heat treatment at 55oC for 20 minutes or 95oC for 2 minutes.

Part Number: 14M0001-B2

Contents: 500 μL (2.5X concentration)

Get More Information

The BioCode® SA-PE Mix contains a Streptavidin Phycoerythrin conjugate in buffer. Streptavidin conjugated to the fluorescent dye (Phycoerythrin) non-covalently binds to biotin. This reaction can be used to detect biotinylated nucleic acids or proteins.

Volume/Concentration: 450 µL per vial; 50 µg/mL Buffer: 137 mM NaCl, 10mM phosphate, 2.7 mM KCl: pH 7.4

Stabilizer: 15 mg/mL BSA | Preservative: 0.05% ProClin 950

Part Number: 63-S0001

Contains: 450 μL x 8 vials

Get More Information

The BioCode® BMB Diluent contains a non-reactive synthetic probe sequence coupled to BMB number 0 in hybridization buffer. This diluent can be used to prepare the desired volume of target specific BMB-Probe(s) for capture/detection assays. The non-reactive BMB-Probe #0 could be used for background subtraction, as an internal negative control or remain unassigned.

Concentration/Volume: 12 BMB/µL in 5 mL SSPE based hybridization buffer per vial

Probe Sequence: TTGTAGAAGGATAAGGTGAGT

Part Number: 44-B0324-B4

Contents: 5 mL x 4 vials

Get More Information

1x wash buffer is used for washing and resuspending BMBs for optical reading.

Part Number: 44-B0003

Contents: 1 L

Get More Information